View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_high_84 (Length: 221)
Name: NF19675_high_84
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 56 - 189
Target Start/End: Original strand, 37167058 - 37167190
Alignment:
| Q |
56 |
aacaaaacatatatttgaagatattcgttataaaaattcattataagttattttaactatatctttgaaaaagaaaagttgcttgtattgaaaaggaata |
155 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37167058 |
aacaaaacatatattagaagatattcgtta-aaaaactcattataagtttttttaactatatctttgaaaaagaaaagttgcttgtattgaaaaggaatc |
37167156 |
T |
 |
| Q |
156 |
ctggccatcccaatgcataatatgcccgcacgta |
189 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||| |
|
|
| T |
37167157 |
ctggccatcccaatgtataatatgcccacacgta |
37167190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University