View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19675_high_86 (Length: 215)

Name: NF19675_high_86
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19675_high_86
NF19675_high_86
[»] chr1 (1 HSPs)
chr1 (20-181)||(46760575-46760735)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 46760735 - 46760575
Alignment:
20 agggggcaacgggcaggatattgtagctttaaggtttctgtataaaacgactcggtcagttggacaaaggctgccctattagtcagcaaagtggagagga 119  Q
    |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
46760735 agggggcaacgggcaggatattatagctttaaggtttctgtataaa-cgactcggtcagttggacaaaggctgccctattagtcagcaaagtggagagga 46760637  T
120 gttgttgttgttgtcattgtgaaatgtgtgaagtatgaagtgagacctaataggatcctgta 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46760636 gttgttgttgttgtcattgtgaaatgtgtgaagtatgaagtgagacctaataggatcctgta 46760575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University