View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_22 (Length: 470)
Name: NF19675_low_22
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 18 - 456
Target Start/End: Complemental strand, 6821148 - 6820710
Alignment:
| Q |
18 |
ggaagtgcttgacaacaactttgttataacaaactgcctttgccagagttgtcttccccacacctttcatccccacaatgcaaagtttcgaagcattatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821148 |
ggaagtgcttgacaacaactttgttataacaaactgcctttgccagagctgtcttccccacacctttcatccccacaatgcaaagtttcgaagcattatc |
6821049 |
T |
|
| Q |
118 |
actgcttgcagtcagattcaagaccaaatcttgttctttgattttcaaaccaacaactttggctgaatcctctcttcggatggtgcaagtttctgtcaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821048 |
actgcttgcagtcagattcaagaccaaatcttgttctttgattttcaaaccaacaactttggctgaatcctctcttcggatggtgcaagtttctgtcaat |
6820949 |
T |
|
| Q |
218 |
tgctgaagaagatcaattgtatttttcatctcaattggattgaactcagggccagttacatactgttctggttgtaaattttccagctcatgaacaatga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6820948 |
tgctgaagaagatcaattgtatttttcatctcaattggattgaactcagtgccagttacatactgttctggttgtaaattttccagctcatgaacaatga |
6820849 |
T |
|
| Q |
318 |
cctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcatttgatccaatgtaacacacattgagttcataac |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6820848 |
cctttagttgctttacacaagcctttatcccttctgtttcttcagctttccgaagctggttatgcatttgatccaatgtaacacatattgagttcataac |
6820749 |
T |
|
| Q |
418 |
cgttcgtacttgctttgagcttgattccagatttttcat |
456 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6820748 |
cgttactacttgctttgagcttgattccagatttttcat |
6820710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 8e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 7333472 - 7333387
Alignment:
| Q |
18 |
ggaagtgcttgacaacaactttgttataacaaactgcctttgccagagttgtcttccccacacctttcatccccacaatgcaaagt |
103 |
Q |
| |
|
||||||||| ||| | | ||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7333472 |
ggaagtgctcgactatatctttgttgtaataaactacctttgccagagttgtcttccccacacctttcatccccacaatggaaagt |
7333387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 319 - 386
Target Start/End: Complemental strand, 7333159 - 7333092
Alignment:
| Q |
319 |
ctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcattt |
386 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||| |||||||| | |||||| |||||||||| |
|
|
| T |
7333159 |
ctttagttcctttacacaagcatttcgcccttctgttttttctgcttccttaagctgcttatgcattt |
7333092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University