View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_52 (Length: 294)
Name: NF19675_low_52
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9574683 - 9574447
Alignment:
| Q |
1 |
tcaagaagtgtgcttgtttatacataacccaaaaacacaacacatgtctttttgaaaagtattatt------attcatggcactattgagtttagcctca |
94 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9574683 |
tcaagaagtgtgcttgtttatacataccccaaaaacacaacacatgtctttatgaaaagtattattcattacattcatggcactattgagtttagcctca |
9574584 |
T |
|
| Q |
95 |
acctatannnnnnnnnnnnnnnnnggaaaactactcacttatacaaacacagactgggctggatgtcccaacaaaagaagatatatctcttattattgag |
194 |
Q |
| |
|
||||||| | ||||||||| |||||||||||| |||||||||| |||||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
9574583 |
acctatatctctctctcctctctcg--aaactactcgcttatacaaacatagactgggctagatgtcccgacacaagaagatatatctctaattattgag |
9574486 |
T |
|
| Q |
195 |
tatatattggtgataatttgatctcttattatgcaaaaa |
233 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9574485 |
tatatattggtgataacttgatctcttattatgcaaaaa |
9574447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 232 - 278
Target Start/End: Complemental strand, 9574707 - 9574661
Alignment:
| Q |
232 |
aagatcaaatatctcttctgaagttcaagaagtgtgcttgtttatac |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9574707 |
aagatcaaatatctcttatgaagttcaagaagtgtgcttgtttatac |
9574661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University