View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_55 (Length: 282)
Name: NF19675_low_55
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 265
Target Start/End: Complemental strand, 29213434 - 29213177
Alignment:
| Q |
8 |
cgaagaaaatccctcgttgacgctaatcttgtgccttctcatatgtcctcccaaagcctggccaagagaaaattctttaccacaaatgtagcacccatgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29213434 |
cgaagaaaatccctcgttgacgctaatcttgtgccttctcatatgtcctcccaaagcctggccaagagaaaattctttaccacaaatgtagcacccatgc |
29213335 |
T |
|
| Q |
108 |
gttttggggttattcaacaaacctaaagtttgagcatgtagcttgagtttcacggtatctagtttgggccttttgtgactagccctatggccacctaggg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29213334 |
attttggggttattcaacaaacctaaagtttgagcatgtagcttgagtttcaaggtatctagtttgggccttttgtgactagccctatggccacctaggg |
29213235 |
T |
|
| Q |
208 |
cttgaaacgaagagaacttgcggttgcatgtggtgcactcaaattccacaggactaaa |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29213234 |
cttgaaacgaagagaacttgcggttgcatgtggtgcactcaaattccacaggactaaa |
29213177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 250
Target Start/End: Complemental strand, 29199961 - 29199891
Alignment:
| Q |
180 |
ttgtgactagccctatggccacctagggcttgaaacgaagagaacttgcggttgcatgtggtgcactcaaa |
250 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||| || ||||| || |||||||| || |||||||||| |
|
|
| T |
29199961 |
ttgtgacttgccctgtgaccacctagggcttgaaaagatgagaatttacggttgcaagttttgcactcaaa |
29199891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 250
Target Start/End: Complemental strand, 29206935 - 29206865
Alignment:
| Q |
180 |
ttgtgactagccctatggccacctagggcttgaaacgaagagaacttgcggttgcatgtggtgcactcaaa |
250 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||| || ||||| || |||||||| || |||||||||| |
|
|
| T |
29206935 |
ttgtgacttgccctgtgaccacctagggcttgaaaagatgagaatttacggttgcaagttttgcactcaaa |
29206865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University