View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_64 (Length: 259)
Name: NF19675_low_64
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 51504962 - 51505185
Alignment:
| Q |
19 |
gaaaatagatagaaaaagtagtatttggtaccttggagagaaaagagtggaaggttgaatgtagcaccagcatccaagaaagcagttctatggcgcgtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51504962 |
gaaaatagatagaaaaagtagtatttggtaccttggagagaaaagagtggaaggttgaatgtagcaccagcatccaagaaagcagttctatggcgcgtgt |
51505061 |
T |
|
| Q |
119 |
cttcaacatctgcattgattgattgagcttagtgaaccaaagaacacaatcgcaaaacaaggaatccatagaattattattaattgcgtaccaccaagat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51505062 |
cttcaacatctgcattgattgattgagcttagtgaaccaaagaacacaatcgcaaaacaaggaatccatagaattattattaattgcgtaccaccaagat |
51505161 |
T |
|
| Q |
219 |
atgtatgcaaagaggcgatacttg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51505162 |
atgtatgcaaagaggcgatacttg |
51505185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University