View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_65 (Length: 254)
Name: NF19675_low_65
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 232
Target Start/End: Original strand, 1196113 - 1196332
Alignment:
| Q |
13 |
attctcggacgattgaagacttggaaagattgattcaaggttatattcaactatgtctcgagcagcttcaagaagacctgaaagtagaaagggtgcccat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1196113 |
attctcggacgattgaagacttggaaagattgattcaaggttatattcaactatgtctcgagcagcttcaagaagacctgaaagtagaaagggtgcccat |
1196212 |
T |
|
| Q |
113 |
gtcgttgctctgtaacgatttacaactgaagtattatgccctggagtccctgttcttccacatcctaatgacaacaacacgaatttggtaggttcgtttg |
212 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1196213 |
ttcgttgctgtgtactgatttacaactgaagtattatgccctggagtccctgttcttccacatcctaatgacaacaacacgaatttggtaggttcgtttg |
1196312 |
T |
|
| Q |
213 |
gattcacaggtatgaaatca |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1196313 |
gattcacaggtatgaaatca |
1196332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 1277097 - 1277171
Alignment:
| Q |
165 |
ttcttccacatcctaatgacaacaacacgaatttggtaggttcgtttggattcacaggtatgaaatcaggattct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
1277097 |
ttcttccacatcctaatgacaacaacacgattttggtaggttcgtttggattcacaggaatgaaattaggattct |
1277171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 239
Target Start/End: Original strand, 1242517 - 1242590
Alignment:
| Q |
166 |
tcttccacatcctaatgacaacaacacgaatttggtaggttcgtttggattcacaggtatgaaatcaggattct |
239 |
Q |
| |
|
|||||||||||||||||| ||||| | || ||||||||||| ||| |||||||| |||||||||| ||||| |
|
|
| T |
1242517 |
tcttccacatcctaatgataacaagaggattttggtaggttgattttcattcacagaaatgaaatcagaattct |
1242590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 239
Target Start/End: Original strand, 1253216 - 1253289
Alignment:
| Q |
166 |
tcttccacatcctaatgacaacaacacgaatttggtaggttcgtttggattcacaggtatgaaatcaggattct |
239 |
Q |
| |
|
|||||||||||||||||| ||||| | || ||||||||||| ||| |||||||| |||||||||| ||||| |
|
|
| T |
1253216 |
tcttccacatcctaatgataacaagaggattttggtaggttgattttcattcacagaaatgaaatcagaattct |
1253289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University