View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_66 (Length: 254)
Name: NF19675_low_66
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_66 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 159 - 254
Target Start/End: Complemental strand, 36947797 - 36947702
Alignment:
| Q |
159 |
cattgctcctttgggattcttcatgttcttgttcaatatagactagtgctgctgatcttcttggacttcgctttgcaccagcagatttaagtgcaa |
254 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947797 |
cattgctcctttgggattcttcatgctcttgttcaatatagactagtgctgctgatcttcttggacttcgctttgcaccagcagatttaagtgcaa |
36947702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 36947941 - 36947882
Alignment:
| Q |
15 |
aatattgtggtacaatgttgttggggactttttctgctctgtccctatatctatccaaac |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947941 |
aatattgtggtacaatgttgttggggactttttctgctctgtccctatatctatccaaac |
36947882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 223 - 253
Target Start/End: Complemental strand, 36955836 - 36955806
Alignment:
| Q |
223 |
acttcgctttgcaccagcagatttaagtgca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36955836 |
acttcgctttgcaccagcagatttaagtgca |
36955806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University