View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19675_low_70 (Length: 250)

Name: NF19675_low_70
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19675_low_70
NF19675_low_70
[»] chr1 (1 HSPs)
chr1 (16-250)||(36809472-36809706)


Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 36809472 - 36809706
Alignment:
16 ataacatgacactaatgaaacaagtatgtcaagaccagcaatagattagaacatatctcaaaccaaaattttaaggcatgaatataagttgtttctctta 115  Q
    |||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||     
36809472 ataatatgacactaatgaaacaagtatgtcaagaccaacaagagattagaacatatctcaaaccaaaattttaaggcatgaatatgagttgtttctcttc 36809571  T
116 taaatctaacatttaagtcattcatagttaatcactcatgcttgaactaaaacactaaccatgattactcttaagaaataacaaggcaaaatagttggca 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
36809572 taaatctaacatttaagtcattcatagttaatcactcatgcttgaactaaaacactaaccaggattactcttaagaaataacaaggcaaaatagttggca 36809671  T
216 ctttgtgtcttttccaatttctttcaccatccaaa 250  Q
    |||||||||||||||||||||||||||||||||||    
36809672 ctttgtgtcttttccaatttctttcaccatccaaa 36809706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University