View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_91 (Length: 215)
Name: NF19675_low_91
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 46760735 - 46760575
Alignment:
| Q |
20 |
agggggcaacgggcaggatattgtagctttaaggtttctgtataaaacgactcggtcagttggacaaaggctgccctattagtcagcaaagtggagagga |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46760735 |
agggggcaacgggcaggatattatagctttaaggtttctgtataaa-cgactcggtcagttggacaaaggctgccctattagtcagcaaagtggagagga |
46760637 |
T |
 |
| Q |
120 |
gttgttgttgttgtcattgtgaaatgtgtgaagtatgaagtgagacctaataggatcctgta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46760636 |
gttgttgttgttgtcattgtgaaatgtgtgaagtatgaagtgagacctaataggatcctgta |
46760575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University