View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_low_92 (Length: 209)
Name: NF19675_low_92
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_low_92 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 43647415 - 43647219
Alignment:
| Q |
13 |
aggtgtcgttcccggcggtgttggagagataggtgtcgtccctggcggtgatggagtgctaggtgacactgctggcggcgatggagtaataggtgtcgtc |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43647415 |
aggtgttgttcccggcggtgttggagagataggtgtcgtccctggcggtgacggagtgctaggtgacactgctggcggcgatggagtaataggcgtcgtc |
43647316 |
T |
 |
| Q |
113 |
cccggcggtgatggagaggttggtgaccctcccgacgatggaggagaggaaggtgaaactcccggcggcgatggcaaaggcaaagaaggattaaaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43647315 |
cccggcggtgatggagaggttggtgaacctcccggcgatggaggagaggaaggtgaaactcccggcggcgatggcaaaggcaaagaaggattaaaag |
43647219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 43647505 - 43647388
Alignment:
| Q |
13 |
aggtgtcgttcccggcggtgttggagagataggtgtcgtccctggcggtgatggagtgctaggtgacactgctggcggcgatggagtaataggtgtcgtc |
112 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| || || ||||| ||||||||||||| || ||| || || ||||| ||||||| || |
|
|
| T |
43647505 |
aggtgtcgttcccggtggtgatggagagataggtgtcgttcccggaggtgaaggagtgctaggtggcaatgccggtggttctggagatgtaggtgttgtt |
43647406 |
T |
 |
| Q |
113 |
cccggcggtgatggagag |
130 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
43647405 |
cccggcggtgttggagag |
43647388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University