View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19675_low_94 (Length: 204)

Name: NF19675_low_94
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19675_low_94
NF19675_low_94
[»] chr4 (1 HSPs)
chr4 (14-182)||(53174101-53174264)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 53174264 - 53174101
Alignment:
14 aatactacttgcatggagttgtggatgagaaaacagatgtgtttgcttttggtgtgttcttgctagaagtcatttctggtaggaaacctgtggatgtgtc 113  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53174264 aatactacttgcatggagttgtggatgagaaaacagatgtatttgcttttggtgtgttcttgctagaagtcatttctggtaggaaacctgtggatgtgtc 53174165  T
114 tcaccaaagtttacatagctgggtaagtaagtagagtagagtagagtagactagccccacttttgattg 182  Q
    |||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||    
53174164 tcaccaaagtttacatagctgggtaagtaagtagagtagag-----tagactagccccacttttgattg 53174101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University