View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19677_high_19 (Length: 214)
Name: NF19677_high_19
Description: NF19677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19677_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 39492040 - 39491979
Alignment:
| Q |
139 |
catgaaaatttcaaatgtctgcaaagttacgttttctatcaaaccttcgatgatcttcctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39492040 |
catgaaaatttcaaatgtctgcaaagttgcgttttctatcaaaccttcgatgatcttcctga |
39491979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 40 - 101
Target Start/End: Complemental strand, 39492104 - 39492041
Alignment:
| Q |
40 |
ttattttttgagcgcaataataagttaaacaaac--atgcacgctagtattattcatagaaaat |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39492104 |
ttattttttaagcgcaataataagttaaacaaacatatgcacgctagtattattcatagaaaat |
39492041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 136
Target Start/End: Original strand, 39287199 - 39287261
Alignment:
| Q |
74 |
atgcacgctagtattattcatagaaaataaaaatataaaatcatggggggacaataaccaaaa |
136 |
Q |
| |
|
||||||||||| |||||| || ||||| | |||||||||||||| |||| |||| |||||||| |
|
|
| T |
39287199 |
atgcacgctagcattattaatcgaaaagataaatataaaatcattggggcacaagaaccaaaa |
39287261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University