View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19677_high_9 (Length: 316)
Name: NF19677_high_9
Description: NF19677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19677_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 12 - 316
Target Start/End: Original strand, 36716794 - 36717098
Alignment:
| Q |
12 |
tatactgcagtaactgaagcaaaagccaatggattttctgatgtcttgttcttggattcagcaactggtaaaaatattgaggaggctactgcgtgcaata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716794 |
tatactgcagtaactgaagcaaaagccaatggattttctgatgtcttgttcttggattcagcaactggtaaaaatattgaggaggctactgcgtgcaata |
36716893 |
T |
 |
| Q |
112 |
tatttgttgtgaaggtgcatcaacgatctttatttcatatgcacatatactactataaacaaatttgatgttcaaagttcaaaccatattttactatatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36716894 |
tatttgttgtgaaggtgcatcaacgatctttatttcatatgcacatatactactataaacaaatttgatgttcaaagttcaaaccatattttactttatc |
36716993 |
T |
 |
| Q |
212 |
caaaacaaaaattggtctaatgtttgtctttcatattaatcttgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716994 |
caaaacaaaaattggtctaatgtttgtctttcatattaatcttgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtc |
36717093 |
T |
 |
| Q |
312 |
acacg |
316 |
Q |
| |
|
||||| |
|
|
| T |
36717094 |
acacg |
36717098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University