View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19678_low_16 (Length: 493)
Name: NF19678_low_16
Description: NF19678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19678_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 108 - 418
Target Start/End: Original strand, 6706155 - 6706465
Alignment:
| Q |
108 |
ctttgaggttgaaatggtttctccttcgggttcgggttcaagttcgttgtgatgagtagtggtggtgatagtgttaagtcttgatgatgatgattcctct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6706155 |
ctttgaggttgaaatggtttctccttcgggttcgggttcaagttcgttgtgatgagtagtggtggtgatagtgttgagtcttgat---gatgattcctct |
6706251 |
T |
 |
| Q |
208 |
tcttcagccattggcctcacaaaaaattcagatcttaaacaattattgtaggtgctatagtcttcaacaaatggaaattggttcatagcacttgttga-- |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6706252 |
tcttcagccattggcctcacaaaaaattcagatcttaaacaattattgtaggtgctatagtcttcaacaaattgaaattggttcatagcacttgttgagt |
6706351 |
T |
 |
| Q |
306 |
-gttgttgtagaaaacataatcaccatttatagttttgtaattttgtttgctactttgagagggaaccatggtcatattgaacaattctcaaaacaagcc |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6706352 |
tgttgttgtagaaaacataatcaccatttatagttttgtaattttgtttgctactttgagaaggaaccatggtcatattgaacaaatctcaaaacaagcc |
6706451 |
T |
 |
| Q |
405 |
atggatgatgatga |
418 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
6706452 |
atggataatgatga |
6706465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 6706048 - 6706082
Alignment:
| Q |
1 |
gtcacggccgtattacctatgcttaattgaagcca |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6706048 |
gtcacggccgtattacctatgcttaattgaagcca |
6706082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University