View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19678_low_22 (Length: 399)
Name: NF19678_low_22
Description: NF19678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19678_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 3e-58; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 24403279 - 24403397
Alignment:
| Q |
16 |
atgcagttctcatggtatcaaattggatcttctaaatattaattactatcgtgcgattttgatcctttcgtttgacaaaattttattttcaaactagaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24403279 |
atgcagttctcatggtatcaaattggatcttctaaatattaattactattgtgcgattttgatcctttcgtttgacaaaattttattttcaaactagaaa |
24403378 |
T |
 |
| Q |
116 |
tgaagatattttaaacaag |
134 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24403379 |
tgaagatattttaaacaag |
24403397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 24403572 - 24403641
Alignment:
| Q |
311 |
gagaaaaattaatctgacagagtgattgccttgatctgtgg-gagaagaatgaaaagagtactgttctgttta |
382 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
24403572 |
gagaaaaattaatc-gacagagtggttgccttgatctgtggagggaagaatg--aagagtactgttctgttta |
24403641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 166 - 237
Target Start/End: Original strand, 12130586 - 12130656
Alignment:
| Q |
166 |
attaagtaacaattacatttgctttccctctgttacaatgattaagatatcaaatcacgaaagcaaatttga |
237 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| |||| || | ||| ||||||||| |||||| ||||||| |
|
|
| T |
12130586 |
attaagtaacaactgcatttgctttccctctgtgacaa-gaatcagaaatcaaatcatgaaagcgaatttga |
12130656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 382
Target Start/End: Original strand, 12131501 - 12131545
Alignment:
| Q |
339 |
ccttgatctgtgg-gagaagaatgaaaagagtactgttctgttta |
382 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
12131501 |
ccttgatctgtggagagatgaatgagaagagtactgttctgttta |
12131545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University