View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19678_low_28 (Length: 312)
Name: NF19678_low_28
Description: NF19678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19678_low_28 |
 |  |
|
| [»] scaffold0277 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 116 - 240
Target Start/End: Original strand, 26720060 - 26720184
Alignment:
| Q |
116 |
aagacattcataatcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttacagaggatagaaaatgagaaggaagtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26720060 |
aagacattcataatcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttacagaggatagaaaatgagaaggaagtt |
26720159 |
T |
 |
| Q |
216 |
tccaacttggtaaaagtgcagattc |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26720160 |
tccaacttggtaaaagtgcagattc |
26720184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 26719945 - 26720032
Alignment:
| Q |
1 |
ttagtgtttttaagctatatatatgatttttgagatccaatcacaatcacattatatctcctttcatgctgatggtgcttcccttaag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26719945 |
ttagtgtttttaagctatatatatgatttttgagatccaatcacaatcacattatatctcctttcatgctgatggtgcttcccttaag |
26720032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 129 - 217
Target Start/End: Complemental strand, 27310899 - 27310811
Alignment:
| Q |
129 |
tcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttacagaggatagaaaatgagaaggaagtttc |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||| ||||||| |||||||||||| | ||||| |||| |||||||||||| |
|
|
| T |
27310899 |
tcacattgctttacagacattacatggaaagaggaggtagaaaaagtgatggttattttaccaaagataggaaataggaaggaagtttc |
27310811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 129 - 217
Target Start/End: Complemental strand, 27581834 - 27581746
Alignment:
| Q |
129 |
tcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttacagaggatagaaaatgagaaggaagtttc |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||| ||||||| |||||||| || ||| ||||| |||| |||||||||||| |
|
|
| T |
27581834 |
tcacattgctttacagacattacatggaaagaggaggtagaaaaagtgatggttattgtatagaagataggaaataggaaggaagtttc |
27581746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 27669719 - 27669616
Alignment:
| Q |
129 |
tcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttacagaggatagaaaatgagaaggaagtttccaacttggtaa |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| | ||||||| ||||||||||| ||| ||||| |||| |||||||||||| || |||||| |
|
|
| T |
27669719 |
tcacattgctttagagaaattacatggaaagaggaggca-aaaaagtgatggttattttagagaagataggaaataggaaggaagtttcttacatggtaa |
27669621 |
T |
 |
| Q |
229 |
aagtg |
233 |
Q |
| |
|
||||| |
|
|
| T |
27669620 |
aagtg |
27669616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 27313321 - 27313261
Alignment:
| Q |
129 |
tcacattgctttacagaaattacatggaaagagcaggtagcaaaagtggtggttattttac |
189 |
Q |
| |
|
||||||||||||||||| | |||||| |||||| |||||| ||||||| |||||||||||| |
|
|
| T |
27313321 |
tcacattgctttacagacactacatgaaaagagaaggtagaaaaagtgatggttattttac |
27313261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 28780832 - 28780876
Alignment:
| Q |
185 |
tttacagaggatagaaaatgagaaggaagtttccaacttggtaaa |
229 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
28780832 |
tttacagaagataggaaatgagaaggaagtttcccacttggtaaa |
28780876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 157
Target Start/End: Original strand, 26847943 - 26847971
Alignment:
| Q |
129 |
tcacattgctttacagaaattacatggaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26847943 |
tcacattgctttacagaaattacatggaa |
26847971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0277 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0277
Description:
Target: scaffold0277; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 5611 - 5563
Alignment:
| Q |
185 |
tttacagaggatagaaaatgagaaggaagtttccaacttggtaaaagtg |
233 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
5611 |
tttacagaagataggaaatgagaaggaagtttcccacttggtaaaagtg |
5563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0277; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 229
Target Start/End: Complemental strand, 14126 - 14082
Alignment:
| Q |
185 |
tttacagaggatagaaaatgagaaggaagtttccaacttggtaaa |
229 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
14126 |
tttacagaagataggaaatgagaaggaagtttcccacttggtaaa |
14082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University