View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19678_low_45 (Length: 216)
Name: NF19678_low_45
Description: NF19678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19678_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 12323715 - 12323896
Alignment:
| Q |
16 |
caccaattaggctgtaatatggaaatgctgttaggtgttttgccttgttattaattaataatgcagatatccaagcacatgaatggtatatgctctcttt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12323715 |
caccaattaggctgtaatgtggaaatgctgttaggtgttttgccttgttatta----ataatgcagatatccaagcacatgaatggtatatgctttcttt |
12323810 |
T |
 |
| Q |
116 |
tgaatgctgatgagtgtcaagattttagtaaagaaagtaagcaaagaaaacattaactaaaagataaacattcaatgtattaatat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12323811 |
tgaatgctgatgagtgtcaagattttagtaaagaaagtaagcaaagaaaacattaactaaaatataaacattcaatgtattaatat |
12323896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University