View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19679_high_7 (Length: 299)
Name: NF19679_high_7
Description: NF19679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19679_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 74 - 289
Target Start/End: Original strand, 9251237 - 9251452
Alignment:
| Q |
74 |
ttattattagtggagaaattccattgaaatctcgcgagtgccattggtgtacgcctccaatgatggctccaaattgtttcatagcaagcatggtacccta |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9251237 |
ttattattagtggagaaattccattgaaatctcgcgagtgccattggtgtacgcctccaatgatggctccaaattgtttcctagcaagcatggtacccta |
9251336 |
T |
 |
| Q |
174 |
tttttgcttgttagcccaaatcaagcattatagcctatttttccacctctattgggataatcgtgcatatgcttccttattggtcctagtttcaattagt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9251337 |
tttttgcttgttagcccaaatcaagcatggtagcctatttttccacctctaatgggataatcgtgcatatgcttccttattggtcctagtttcaattagt |
9251436 |
T |
 |
| Q |
274 |
ggccgtttttcctttg |
289 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9251437 |
ggccgtttttcctttg |
9251452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University