View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19679_high_8 (Length: 296)
Name: NF19679_high_8
Description: NF19679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19679_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 122 - 296
Target Start/End: Complemental strand, 41480018 - 41479844
Alignment:
| Q |
122 |
caaaaacggaaaggcaaactgaaactacatgagtctaagtggaagagacgacagaggataaaaaggcatgaggagatgtcaacttagaaaactgatacca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41480018 |
caaaaacggaaaggcaaactgaaactacatgagtctaagtggaagagacgacagaggataaaaaggcatgaggagatgtcaacttagaaaactgatacca |
41479919 |
T |
|
| Q |
222 |
atttaaaagaaaggattccagaaattaacttttcattacttctcaacaggtttcattacataagattacaacttc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41479918 |
atttaaaagaaaggattccagaaattaacttttcattacttctcaacaggtttcattacataagattacaacttc |
41479844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 103
Target Start/End: Complemental strand, 24084564 - 24084511
Alignment:
| Q |
49 |
gaggatgaaccagaaagtagtttggatttcttagttatgacttatgtctttattt |
103 |
Q |
| |
|
|||||||||| ||||||||||| |||||| | ||||||| ||||||||||||||| |
|
|
| T |
24084564 |
gaggatgaactagaaagtagttaggatttatgagttatg-cttatgtctttattt |
24084511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University