View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19680_high_14 (Length: 236)
Name: NF19680_high_14
Description: NF19680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19680_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 97 - 217
Target Start/End: Complemental strand, 45983115 - 45982995
Alignment:
| Q |
97 |
aatatttccatcattgtgctgttgaactgaaattttgggaatcgaattgtggcgggaatggaaggaagtgagagcgaggccgtttttgaatcggtgatga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45983115 |
aatatttccatcattgtgctgttgaactgaaattttgggaatcgaattgtggcgggaatggaaggaagtgagagcgaggccgtttttgaatcggtgatga |
45983016 |
T |
 |
| Q |
197 |
atctgaatccacaactcttct |
217 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45983015 |
atctgaatccacaactcttct |
45982995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 45867961 - 45868012
Alignment:
| Q |
166 |
gagagcgaggccgtttttgaatcggtgatgaatctgaatccacaactcttct |
217 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
45867961 |
gagagcgatgcgattttcgaatcggtgatgaatttgaatccacaactcttct |
45868012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University