View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19680_high_6 (Length: 365)
Name: NF19680_high_6
Description: NF19680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19680_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 16 - 348
Target Start/End: Complemental strand, 6878922 - 6878590
Alignment:
| Q |
16 |
atacacaactcaaaccaaccaacacttccactatggcagtctctgccttctccaaatcagagtaatgcaatgtctgcagaagcattgccgtaggctttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878922 |
atacacaactcaaaccaaccaacacttccactatggcagtctctgccttctccaaatcagagtaatgcaatgtctgcagaagcattgccgtaggctttgt |
6878823 |
T |
 |
| Q |
116 |
ctcaaatcttgtcttctccaaatgcctttccccatgccaccggactgtgtcatgcgccaccggagacagccattccattagctcctccaccgcctcccgc |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878822 |
ctcgaatcttgtcttctccaaatgcctttccccatgccaccggactgtgtcatgcgccaccggagacagccattccattagctcctccaccgcctcccgc |
6878723 |
T |
 |
| Q |
216 |
cacccttcggccagtgagtgcccgtcatttccttcgtctccctctttcgcccaccgtccccttagcttcgcctttaccttcattcttaatctgcccggta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6878722 |
cacccttcggccagtgagtgcccgtcatttccttcgtctccctctttcgcccaccgtccccttagcttcgcctttaccttcattcttaatcttcccggta |
6878623 |
T |
 |
| Q |
316 |
gcatctcgtataaggcctcacgtgcgtcctctc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6878622 |
gcatctcgtataaggcctcacgtgcgtcctctc |
6878590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University