View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19680_high_9 (Length: 311)
Name: NF19680_high_9
Description: NF19680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19680_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 6083395 - 6083682
Alignment:
| Q |
19 |
gcattgatgattggattagagtctgttgagaaggataatacttctctgatgtatgaggctcgagtgcttcaaaaggaacttgatattcgaaatgaagtcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083395 |
gcattgatgattggattagagtctgttgagaaggataatacttctctgatgtatgaggctcgagtgcttcaaaaggaacttgatattcgaaatgaagtcc |
6083494 |
T |
 |
| Q |
119 |
aattttcaagagtaatgctttcgcaaacagcgtcaaaactgttgcaacttgaatctgagattgattccaaaaaccaagtagcatcggagcagcctagaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083495 |
aattttcaagagtaatgctttcgcaaacagcgtcaaaactgttgcaacttgagtctgagattgattccaaaaaccaagtagcatcggagcagcctagaag |
6083594 |
T |
 |
| Q |
219 |
tcatgttgcattgcaagagttatctttggcatcaatgtcttacattggcagtgatgacaatgttagctgtggggagtcctttgcttct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
6083595 |
tcatgttgcattgcaagagttatctttggcatcaatgtcttacattggcagtgatgacaatgttagctgcggggagtccttggcttct |
6083682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 289
Target Start/End: Complemental strand, 39107438 - 39107390
Alignment:
| Q |
241 |
tctttggcatcaatgtcttacattggcagtgatgacaatgttagctgtg |
289 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| |||||||||| |
|
|
| T |
39107438 |
tctttggcatcaacgtctgatattggcagtgatgacaaggttagctgtg |
39107390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University