View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19680_low_8 (Length: 313)
Name: NF19680_low_8
Description: NF19680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19680_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 12 - 299
Target Start/End: Original strand, 45968798 - 45969082
Alignment:
| Q |
12 |
acagaggtggaaaaagatgcatggaagttattgcagaaagcgcttgttacatattgtgatacacctgttggaactgttgcggcaaatgatgattcggggt |
111 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968798 |
acagatgtggagaaagatgcatggaagttattgcagaaagcgcttgttacatattgtgatacacctgttggaactgttgcggcaaatgatgattcggggt |
45968897 |
T |
|
| Q |
112 |
cacccttgaattatgatcaggtctttattcgagatttcgtcccttctgctcttgctttcttgcttaaaggagaacatgagattgtcaagaactttctcct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968898 |
cacccttgaattatgatcaggtctttattcgagatttcgtcccttctgctcttgctttcttgcttaaaggagaacatgagattgtcaagaactttctcct |
45968997 |
T |
|
| Q |
212 |
tcacaccttgcaactccaggtaataattatcttcggtgtcttttttgtgtgtatattttgttaatttgttcgtatttcttgttaaata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45968998 |
tcacaccttgcaactccaggtaataattatcttcggtgtcttttttgtgtgtatattttgttaatttgt---tatttcttgttaaata |
45969082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 117 - 235
Target Start/End: Complemental strand, 37654993 - 37654875
Alignment:
| Q |
117 |
ttgaattatgatcaggtctttattcgagatttcgtcccttctgctcttgctttcttgcttaaaggagaacatgagattgtcaagaactttctccttcaca |
216 |
Q |
| |
|
|||||||||||||| || |||||||| ||||| || || || ||||||||||| ||||||||||| || ||||||||| ||| ||||||| ||||| | |
|
|
| T |
37654993 |
ttgaattatgatcaagtgtttattcgggattttgttccgtcggctcttgcttttttgcttaaaggggatactgagattgttaagtactttcttcttcata |
37654894 |
T |
|
| Q |
217 |
ccttgcaactccaggtaat |
235 |
Q |
| |
|
|||||||| | |||||||| |
|
|
| T |
37654893 |
ccttgcaattgcaggtaat |
37654875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University