View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19681_low_6 (Length: 237)
Name: NF19681_low_6
Description: NF19681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19681_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 45011777 - 45011992
Alignment:
| Q |
5 |
atgaatcacacaattgaatgtcaaattagagttaaacctagaccagctgaccccaaaagatccttaaactatacaaagatgtgacaaatacatggtcatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
45011777 |
atgaatcacacagttgaatgtcaaattagaattaaacctagaccagctgacaccaaaagatccttaaactatacaaagatgtaacaaatacggggtcatt |
45011876 |
T |
 |
| Q |
105 |
actaactccctcactaaccacccaacactatataccaaactttggaggacaaaatcacatttcacaaatagtcttgacagaacaaccgcaaaaaacacga |
204 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45011877 |
actaactcccgcactaaccaccttacactatataccaaac-ttggaggacaaaatcacatttcacaaatagttttgacagaacaaccgcaaaaaacacga |
45011975 |
T |
 |
| Q |
205 |
gaggtagtattcggatc |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45011976 |
gaggtagtattcggatc |
45011992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University