View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19683_high_11 (Length: 213)
Name: NF19683_high_11
Description: NF19683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19683_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 53935486 - 53935298
Alignment:
| Q |
12 |
gaagaatatgtctgtacgtatgtttgagattcaacttttgaaccttgtgatagaagaattgattgcattgcagttgcaagcagaggcaggtcccatactg |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53935486 |
gaagaaaatgtctgtacgtatgtttgagattcaacttttgaaccttgtgatagaagaattgattgcattgcagttgcaagcagaggcaggtcccatactg |
53935387 |
T |
 |
| Q |
112 |
tgttttaactctgtttcattttcctggaaattcga------gtccccatgctccctttatactatatactactctatacaaatgcatgc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53935386 |
tgttttaactctgtttcattttcctggaaattcgagtccgagtccccatgctccctttatactatatactactctatacaactgcatgc |
53935298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University