View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19683_low_11 (Length: 213)

Name: NF19683_low_11
Description: NF19683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19683_low_11
NF19683_low_11
[»] chr4 (1 HSPs)
chr4 (12-194)||(53935298-53935486)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 53935486 - 53935298
Alignment:
12 gaagaatatgtctgtacgtatgtttgagattcaacttttgaaccttgtgatagaagaattgattgcattgcagttgcaagcagaggcaggtcccatactg 111  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53935486 gaagaaaatgtctgtacgtatgtttgagattcaacttttgaaccttgtgatagaagaattgattgcattgcagttgcaagcagaggcaggtcccatactg 53935387  T
112 tgttttaactctgtttcattttcctggaaattcga------gtccccatgctccctttatactatatactactctatacaaatgcatgc 194  Q
    |||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||| |||||||    
53935386 tgttttaactctgtttcattttcctggaaattcgagtccgagtccccatgctccctttatactatatactactctatacaactgcatgc 53935298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University