View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19683_low_7 (Length: 265)
Name: NF19683_low_7
Description: NF19683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19683_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 28001334 - 28001100
Alignment:
| Q |
19 |
actagcaacaatacttagaagcgtgatggcttgtccgcacgagcgggcctctcgcgtcccaagctcatgataatttcaatttgcaatgttctctgtattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001334 |
actagcaacaatacttagaagcgtgatggcttgtccgcacgagcgggcctctcgcgtcccaagctcatgataatttcaatttgcaatgttctctgtattt |
28001235 |
T |
 |
| Q |
119 |
tgctgcatttgccattttgtgactactatttaattggtgtctgtaggatcagataaatatcaatggacacactgcatgcatagtttattattaatcaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001234 |
tgctgcatttgccattttgtgactactatttaattggtgtctgtaggatcagataaatatcaatggacacactgcatgcatagtttattattaatcaatt |
28001135 |
T |
 |
| Q |
219 |
tgtctttaatcgctagcaccaatgttcaatgttca |
253 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28001134 |
tgtctttaatcgctagcaccaatattcaatgttca |
28001100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University