View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19683_low_9 (Length: 244)
Name: NF19683_low_9
Description: NF19683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19683_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 35 - 239
Target Start/End: Complemental strand, 29075894 - 29075691
Alignment:
| Q |
35 |
gttagcattgtagcaaaaaacaattgcctctttacatttatggaagtagtactgaaacttttattataagtagcaaaaacaaaaatcgtgcaaactttta |
134 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29075894 |
gttagcattgtagcaaaaaaatattgcctctttacatttatggaagtagtactgaaacttttattgtaagtagcaaaaacaaaaatcgtgcaaactttta |
29075795 |
T |
|
| Q |
135 |
ttttgtcgccattgattccaatagttannnnnnncctaacaattgaaaacaacactagaaaatagcacttccatatttcctcttcaatcacaattttatc |
234 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29075794 |
ttttgtcaccattgattccaatagtta-ttttttcctaacaattgaaaacaacactagaaaatagcacttccatatttcctcttcaatcacaattttatc |
29075696 |
T |
|
| Q |
235 |
tcatt |
239 |
Q |
| |
|
||||| |
|
|
| T |
29075695 |
tcatt |
29075691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 35 - 239
Target Start/End: Complemental strand, 29109059 - 29108853
Alignment:
| Q |
35 |
gttagcattgtagcaaaaaacaat--tgcctctttacatttatggaagtagtactgaaacttttattataagtagcaaaaacaaaaatcgtgcaaacttt |
132 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
29109059 |
gttagcattgtagcaaaaaaaaaaaatgcctctttacatttatggaagtagtactgaaacttttattgtaagtagcaaaaaaaaaaatcgtgcaaacttt |
29108960 |
T |
|
| Q |
133 |
tattttgtcgccattgattccaatagttannnnnnncctaacaattgaaaacaacactagaaaatagcacttccatatttcctcttcaatcacaatttta |
232 |
Q |
| |
|
||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29108959 |
tatattgtcaccattgattccaatagttatttttttcctaacaattgaaaacaacactagaaaatagcacttccatatttcctcttcaatcacaatttta |
29108860 |
T |
|
| Q |
233 |
tctcatt |
239 |
Q |
| |
|
||||||| |
|
|
| T |
29108859 |
tctcatt |
29108853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 141
Target Start/End: Complemental strand, 29861154 - 29861113
Alignment:
| Q |
100 |
ataagtagcaaaaacaaaaatcgtgcaaacttttattttgtc |
141 |
Q |
| |
|
|||| |||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
29861154 |
ataaatagcaaaaacaaaaatggtgcaatcttttattttgtc |
29861113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University