View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19685_high_10 (Length: 250)
Name: NF19685_high_10
Description: NF19685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19685_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 44426015 - 44425796
Alignment:
| Q |
12 |
gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44426015 |
gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaagctgagagctgctcaaactgaggtggaagaattgatttcaaaaa |
44425916 |
T |
 |
| Q |
112 |
tctgttcactggaggaagagattgataaagagcgggctttgtctgcagataaactcgagctagaggttgatttaatcgagtgccaaaaacagctcaaggt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44425915 |
tctgttcactggaggaagagattgataaagagcgggctttgtctgcagataaacttgagctagaggttgatttaatcgagtgccaaaaacagctcaaggt |
44425816 |
T |
 |
| Q |
212 |
atcacaaagtcgggtaaagg |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44425815 |
atcacaaagtcgggtaaagg |
44425796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 44425733 - 44425588
Alignment:
| Q |
12 |
gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa |
111 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
44425733 |
gaagaatatgaagaactaaaagtatcccgagcaaaaaatgagaatgctgagtcaaaactgagagctactcaaactgaggcagaagaattgatctcaaaaa |
44425634 |
T |
 |
| Q |
112 |
tctgttcactggaggaagagattgataaagagcgggctttgtctgc |
157 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44425633 |
tctgttcactggaggaagagattgagaaagagcgggctttgtctgc |
44425588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 44426153 - 44426078
Alignment:
| Q |
156 |
gcagataaactcgagctagaggttgatttaatcgagtgccaaaaacagctcaaggtatcacaaagtcgggtaaagg |
231 |
Q |
| |
|
||||||||| | ||||||||| | ||||||| ||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
44426153 |
gcagataaaatagagctagagatggatttaaatgagtgccaaaagcagctcgtggtatcacaaagtcgggtaaagg |
44426078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 39572696 - 39572551
Alignment:
| Q |
12 |
gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa |
111 |
Q |
| |
|
|||| |||||||||||| |||| | || | |||| || |||| ||||||||| ||||| | | ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
39572696 |
gaagcatatgaagaactgaaagaaaccaaaacaaagaaggagatagttgagtcgaaactcaaatttgctcaaactgaggtagaagaactgatttcaaaaa |
39572597 |
T |
 |
| Q |
112 |
tctgttcactggaggaagagattgataaagagcgggctttgtctgc |
157 |
Q |
| |
|
|| |||| |||||||||||||| | || || || ||||||||||| |
|
|
| T |
39572596 |
tccattcattggaggaagagattcaaaaggaacgtgctttgtctgc |
39572551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University