View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19685_low_11 (Length: 250)

Name: NF19685_low_11
Description: NF19685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19685_low_11
NF19685_low_11
[»] chr3 (3 HSPs)
chr3 (12-231)||(44425796-44426015)
chr3 (12-157)||(44425588-44425733)
chr3 (156-231)||(44426078-44426153)
[»] chr8 (1 HSPs)
chr8 (12-157)||(39572551-39572696)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 44426015 - 44425796
Alignment:
12 gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44426015 gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaagctgagagctgctcaaactgaggtggaagaattgatttcaaaaa 44425916  T
112 tctgttcactggaggaagagattgataaagagcgggctttgtctgcagataaactcgagctagaggttgatttaatcgagtgccaaaaacagctcaaggt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
44425915 tctgttcactggaggaagagattgataaagagcgggctttgtctgcagataaacttgagctagaggttgatttaatcgagtgccaaaaacagctcaaggt 44425816  T
212 atcacaaagtcgggtaaagg 231  Q
    ||||||||||||||||||||    
44425815 atcacaaagtcgggtaaagg 44425796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 44425733 - 44425588
Alignment:
12 gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa 111  Q
    ||||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||  ||||||||||| |||||||    
44425733 gaagaatatgaagaactaaaagtatcccgagcaaaaaatgagaatgctgagtcaaaactgagagctactcaaactgaggcagaagaattgatctcaaaaa 44425634  T
112 tctgttcactggaggaagagattgataaagagcgggctttgtctgc 157  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||    
44425633 tctgttcactggaggaagagattgagaaagagcgggctttgtctgc 44425588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 44426153 - 44426078
Alignment:
156 gcagataaactcgagctagaggttgatttaatcgagtgccaaaaacagctcaaggtatcacaaagtcgggtaaagg 231  Q
    ||||||||| | ||||||||| | |||||||  ||||||||||| ||||||  |||||||||||||||||||||||    
44426153 gcagataaaatagagctagagatggatttaaatgagtgccaaaagcagctcgtggtatcacaaagtcgggtaaagg 44426078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 39572696 - 39572551
Alignment:
12 gaagaatatgaagaacttaaagcatcccgagcaaaaaatgagaaagttgagtcaaaactgagagctgctcaaactgaggtggaagaattgatttcaaaaa 111  Q
    |||| |||||||||||| |||| | ||  | |||| || |||| ||||||||| ||||| | |  ||||||||||||||| |||||| ||||||||||||    
39572696 gaagcatatgaagaactgaaagaaaccaaaacaaagaaggagatagttgagtcgaaactcaaatttgctcaaactgaggtagaagaactgatttcaaaaa 39572597  T
112 tctgttcactggaggaagagattgataaagagcgggctttgtctgc 157  Q
    ||  |||| |||||||||||||| | || || || |||||||||||    
39572596 tccattcattggaggaagagattcaaaaggaacgtgctttgtctgc 39572551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University