View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19685_low_12 (Length: 236)
Name: NF19685_low_12
Description: NF19685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19685_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 14526706 - 14526909
Alignment:
| Q |
16 |
aatataatctgtgtactaagatcataaatattgtaaacaatataatcaaccaaagaaagtgattcagattggaccatccagaaaatgaagaaaccagtcc |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526706 |
aatataatcagtgtactaagatcataaatattgtaaacaatataatcaaccaaagaaagtgattcagattggaccatccagaaaatgaagaaaccagtcc |
14526805 |
T |
 |
| Q |
116 |
ctctcatattttctcaatgcctcaaactacttctaatcaagtttgtactactatcagaaactataatagcagaaccaagagcagagacagttatgataac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14526806 |
ctctcatattttctcaatgcctcaaactacttctaatcaagtttgtactactatcagaaactataatagcagaaccaagagcaaagacagttatgataac |
14526905 |
T |
 |
| Q |
216 |
atgt |
219 |
Q |
| |
|
|||| |
|
|
| T |
14526906 |
atgt |
14526909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University