View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19686_low_7 (Length: 296)
Name: NF19686_low_7
Description: NF19686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19686_low_7 |
 |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0636 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0074 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 105 - 277
Target Start/End: Original strand, 34710393 - 34710565
Alignment:
| Q |
105 |
tgttctatttttatttatgttatattactgtaatttgaccattagttatttatgaaattcagacttttattatttatattgtactgctcattttgtgaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34710393 |
tgttctatttttatttatgttatattgctgtaatttgaccattagttatttatgaaattcatacttttattatttatattgtagtgctcattttgtgaac |
34710492 |
T |
 |
| Q |
205 |
acctttaatctttaagattttgaacattattctattattagaaaatatatttcagctaaatagacccgtgcgg |
277 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
34710493 |
acctttgatctttaagattttgaacattattctattattagaagatatatttcagctaaacagactcgtgcgg |
34710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 25 - 96
Target Start/End: Complemental strand, 12819429 - 12819358
Alignment:
| Q |
25 |
gaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| | ||| ||||||||| ||| ||||||||| |
|
|
| T |
12819429 |
gaaccggctaaccctccggttcacggtcggaccggttcgactggccgatccggtccgagttttaaaactatg |
12819358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 25768607 - 25768681
Alignment:
| Q |
22 |
accgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||| | |||||| |||||||||||| ||| |||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
25768607 |
accgaaccagataccccaccggttcacggttggatcggtccgaccgaccggttcgagccggttttcaaaactatg |
25768681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Original strand, 2860299 - 2860353
Alignment:
| Q |
43 |
gttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatga |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| ||| |||||||||| |
|
|
| T |
2860299 |
gttcacggtcggaccggttcgaccggccggtccgatccgagttttaaaactatga |
2860353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 34856808 - 34856883
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||||| ||||| |||||||| |||| || |||||| |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
34856808 |
cgaaccggacaccccaccggttcatggtccgatcggttcaaccggccggtccgagccggttttaaaaactatgatt |
34856883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 96
Target Start/End: Complemental strand, 32987581 - 32987552
Alignment:
| Q |
67 |
gaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32987581 |
gaccggtccggtccggttttcaaaactatg |
32987552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 60
Target Start/End: Complemental strand, 32987608 - 32987575
Alignment:
| Q |
27 |
accggttacccctccggttcacggtcggaccggt |
60 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
32987608 |
accggttacccttccggttcacggtcggaccggt |
32987575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 41220003 - 41219947
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||| ||||||||| ||| ||||||||| |
|
|
| T |
41220003 |
ccggttcacggtcgaaccggttcaaccggccgatccggtccgagttttaaaactatg |
41219947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 22)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 97 - 277
Target Start/End: Original strand, 9642342 - 9642520
Alignment:
| Q |
97 |
atttttgttgttctatttttatttatgttatattactgtaatttgaccattagttatttatgaaattcagacttttattatttatattgtactgctcatt |
196 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9642342 |
atttttgctgttctatttttatttatgttatattgctgtaat--gacctttagttatttatgaaattcagacttttattatttatattgtagtgctcatt |
9642439 |
T |
 |
| Q |
197 |
ttgtgaacacctttaatctttaagattttgaacattattctattattagaaaatatatttcagctaaatagacccgtgcgg |
277 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
9642440 |
ttgtgaacacctttgatctttaagattttgaacattattctattattagaagatatatttaagctaaacagacccgtgcgg |
9642520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 109 - 276
Target Start/End: Original strand, 54528128 - 54528295
Alignment:
| Q |
109 |
ctatttttatttatgttatattactgtaatttgaccattagttatttatgaaattcagacttttattatttatattgtactgctcattttgtgaacacct |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
54528128 |
ctatttttatttatgttatattgctgtaatttgaccattagttatttatgaaattcagatttttattatttatattgtagtgctcattttgtaaacacct |
54528227 |
T |
 |
| Q |
209 |
ttaatctttaagattttgaacattattctattattagaaaatatatttcagctaaatagacccgtgcg |
276 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
54528228 |
ttgatcttcaagattttgaacattattctattattagaagatatatttcagctaagcagatccgtgcg |
54528295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 2848574 - 2848494
Alignment:
| Q |
16 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
2848574 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
2848494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 33635793 - 33635879
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
33635793 |
aatatgtcaaccgaaccggttacccctccgattcacggtcggaccggttcgaccggccgatccggtccggttttcaaaactatgatt |
33635879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 10258397 - 10258314
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||| ||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
10258397 |
aatatgtcaaccgaaccggttacccctccggttcacggtccgactggttcgatcggccggtccggtccggttttcaaaactatg |
10258314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 156 - 279
Target Start/End: Complemental strand, 40162883 - 40162761
Alignment:
| Q |
156 |
atgaaattcagacttttattatttatattgtactgctcattttgtgaacacctttaatctttaagattttgaacattattctattattagaaaatatatt |
255 |
Q |
| |
|
||||||||||||||||||||||| || ||||| |||||||||||||||||| ||| |||||||| |||| || |||||| ||||||| ||| |||| || |
|
|
| T |
40162883 |
atgaaattcagacttttattatt-atgttgtagtgctcattttgtgaacacatttgatctttaaaatttgaaatattattttattatttgaagatatgtt |
40162785 |
T |
 |
| Q |
256 |
tcagctaaatagacccgtgcggtg |
279 |
Q |
| |
|
| ||||||| |||| |||||||| |
|
|
| T |
40162784 |
taagctaaacagacatgtgcggtg |
40162761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 100 - 172
Target Start/End: Complemental strand, 40162970 - 40162900
Alignment:
| Q |
100 |
tttgttgttctatttttatttatgttatattactgtaatttgaccattagttatttatgaaattcagactttt |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40162970 |
tttgttgttctatttttatttatcttatattgct-taatt-gaccattagttatttatgaaattcagactttt |
40162900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 51536430 - 51536374
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
51536430 |
ccggttcacggtcggaccggttcgaccggccggtccgatccggtttttaaaactatg |
51536374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 23241365 - 23241317
Alignment:
| Q |
50 |
gtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
23241365 |
gtcggaccggttcaaccggccggtccggtccggttttcaaaactatgat |
23241317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 11334847 - 11334772
Alignment:
| Q |
25 |
gaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
|||||||| ||||| | ||||||| |||||||||||| || | |||||||||||||||||||||||||||| |||| |
|
|
| T |
11334847 |
gaaccggtcaccccactggttcacagtcggaccggtta-actggccggtccggtccggttttcaaaactatggtttt |
11334772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 42908682 - 42908738
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| | |||||| ||||||||| |
|
|
| T |
42908682 |
ccggttcacggtcggaccggttcgaccggccggtccgagctggtttttaaaactatg |
42908738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 24 - 95
Target Start/End: Complemental strand, 11675620 - 11675549
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactat |
95 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||| ||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
11675620 |
cgaaccggtcaccccaccggttcctggtcggaccgattcaaccggtcggtccggtccgattttcaaaactat |
11675549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 99
Target Start/End: Complemental strand, 16056857 - 16056799
Alignment:
| Q |
41 |
cggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
16056857 |
cggttcccggtcggaccggttcgaccagccggtccgagccggtttttaaaactatgatt |
16056799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 29728805 - 29728859
Alignment:
| Q |
42 |
ggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| || ||||| ||||||||| |
|
|
| T |
29728805 |
ggttcacggtcggaccggttcgaccggccggtccgagccagtttttaaaactatg |
29728859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 78
Target Start/End: Original strand, 39851417 - 39851471
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
39851417 |
cgaaccggtcacctcaccggttcacggtcggaccggttcaaccggccggtccggt |
39851471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 15101427 - 15101471
Alignment:
| Q |
49 |
ggtcggaccggttcgaccgaccggtccggtccggttttcaaaact |
93 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
15101427 |
ggtcggaccggttcgaccggccggtccgagccggttttcaaaact |
15101471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 30464553 - 30464497
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
30464553 |
ccggttcctggtcggaccggttcaaccggccggtccggtctgattttcaaaactatg |
30464497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 37599258 - 37599186
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| | ||||| ||||||| |||||||||||||| |||| ||||||| |||| |||||||||||||| |
|
|
| T |
37599258 |
cgaaccgatcaccccaccggttcctggtcggaccggttcaaccggccggtccaatccgattttcaaaactatg |
37599186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 98
Target Start/End: Complemental strand, 45103403 - 45103345
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
|||||||||||||| |||||||||| || ||||||||||||| ||| |||| |||||| |
|
|
| T |
45103403 |
ccggttcacggtcgaaccggttcgatcggccggtccggtccgagttttaaaattatgat |
45103345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 53612618 - 53612692
Alignment:
| Q |
22 |
accgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||| | |||| |||||| | ||| |||||||||||||| ||| ||||||||| ||| ||||||||| |
|
|
| T |
53612618 |
accgaaccggtcatcccttcggttcgcagtccgaccggttcgaccggccgatccggtccgaattttaaaactatg |
53612692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 33895765 - 33895716
Alignment:
| Q |
27 |
accggttacccctccggttcacggtcggaccggttcgaccgaccggtccg |
76 |
Q |
| |
|
|||||||||| | |||||| |||||||||||| |||||||||||| |||| |
|
|
| T |
33895765 |
accggttacctcaccggtttacggtcggaccgattcgaccgaccgatccg |
33895716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 51228814 - 51228770
Alignment:
| Q |
49 |
ggtcggaccggttcgaccgaccggtccggtccggttttcaaaact |
93 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
51228814 |
ggtcggaccggttgaaccggccggtccggtccgggtttcaaaact |
51228770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 4e-38; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 11733559 - 11733479
Alignment:
| Q |
16 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11733559 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
11733479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 29984156 - 29984242
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29984156 |
aatatgtcaaccgaaccggttacccctccggttcacggtcggaccgattcaaccggccggtccggtccggttttcaaaactatgatt |
29984242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 36859048 - 36859113
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36859048 |
aatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggt |
36859113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 47424638 - 47424703
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
47424638 |
aatatgtcaaccgaaccggttacccctccgattcatggtcggaccggttcgaccggccggtccggt |
47424703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 36098880 - 36098824
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
36098880 |
ccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
36098824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 96
Target Start/End: Complemental strand, 34258558 - 34258499
Alignment:
| Q |
37 |
cctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34258558 |
cctccagttcacggtcggaccggttcgaccgaccggtccgatccgggtttcaaaactatg |
34258499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 47424371 - 47424436
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
47424371 |
aatatgtcaaccgaaccggttacctctccgattcatggtcggaccggttcgaccggccggtccggt |
47424436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 56 - 96
Target Start/End: Complemental strand, 10991975 - 10991935
Alignment:
| Q |
56 |
ccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10991975 |
ccggttcgaccgaccggtccggtccgggtttcaaaactatg |
10991935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 16198028 - 16197972
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||| |||||| ||||||||||||| |
|
|
| T |
16198028 |
ccggttcacggtcggaccggtccaaccggccggtccagtccgggtttcaaaactatg |
16197972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 47 - 98
Target Start/End: Complemental strand, 34191007 - 34190956
Alignment:
| Q |
47 |
acggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
34191007 |
acggtcggatcggttcgaccggccggtccggtctggtttttaaaactatgat |
34190956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 96
Target Start/End: Original strand, 49096489 - 49096557
Alignment:
| Q |
27 |
accggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| | | |||| |||||| ||||| ||||||||||||||| |
|
|
| T |
49096489 |
accggttacccttccggttcacggttggaccgatccaaccggccggtctggtcc-gttttcaaaactatg |
49096557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 14801354 - 14801282
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||| ||||| |||| || ||||| |||||||| |||| ||| ||||||||| |||||||||||||| |
|
|
| T |
14801354 |
cgaaccggtcaccccaccggatcctggtcgaaccggttcaaccggccgatccggtccgattttcaaaactatg |
14801282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 15248346 - 15248274
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||| ||||| |||| || ||||| |||||||| |||| ||| ||||||||| |||||||||||||| |
|
|
| T |
15248346 |
cgaaccggtcaccccaccggatcctggtcgaaccggttcaaccggccgatccggtccgattttcaaaactatg |
15248274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 22350554 - 22350471
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22350554 |
aatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggtccggttttcaaaactatg |
22350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 30270271 - 30270348
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| | || ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30270271 |
cgaaccggttaccccatcggttcctggtcggaccggttcaatcggccgatccggtctggttttcaaaactatgatttt |
30270348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 21528171 - 21528099
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
21528171 |
cgaaccggttaccctaccggttcctggtcggaccggttgaaccggccggtccggtccgggtttcaaaactatg |
21528099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 24067392 - 24067318
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
24067392 |
aatatgtcaaccgaaccggttacccctccggttca---------cggttcgaccggccggtccggtccgattttcaaaactatg |
24067318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 96
Target Start/End: Original strand, 23596686 - 23596735
Alignment:
| Q |
47 |
acggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
23596686 |
acggtcggaccggttcgaccgtccggtccggtctggttttaaaaactatg |
23596735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 48 - 96
Target Start/End: Original strand, 11466191 - 11466239
Alignment:
| Q |
48 |
cggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11466191 |
cggttggaccggttcaaccggccggtccggtccggttttcaaaactatg |
11466239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 8760291 - 8760205
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
8760291 |
aatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccgatccggtccggttttcaaaactatgatt |
8760205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 40 - 102
Target Start/End: Original strand, 40144657 - 40144719
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgattttt |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
40144657 |
ccggttcacggtcggaccggttcaaccgaccggtccggcccggttttcaaaactatgcttttt |
40144719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 97
Target Start/End: Original strand, 22638777 - 22638850
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatga |
97 |
Q |
| |
|
||||||| | ||||| ||||||| |||||||||||||| |||| |||||||| |||| ||||||||||||||| |
|
|
| T |
22638777 |
cgaaccgatcaccccaccggttcctggtcggaccggttcaaccggccggtccgatccgattttcaaaactatga |
22638850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 33898224 - 33898152
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
33898224 |
cgaaccggccaccccatcggttccaggtcggaccggtccaaccggccggttcggtccggttttcaaaactatg |
33898152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 78
Target Start/End: Complemental strand, 36745580 - 36745546
Alignment:
| Q |
44 |
ttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
36745580 |
ttcacggtcggaccggttcgaccggccggtccggt |
36745546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 96
Target Start/End: Original strand, 6460565 - 6460622
Alignment:
| Q |
39 |
tccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||| || || ||||||||||||| |
|
|
| T |
6460565 |
tccggttcacagtcggactggttcgaccggccggtcctgttcgtgtttcaaaactatg |
6460622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 32623067 - 32623011
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||| ||| ||||||||| |
|
|
| T |
32623067 |
ccggttcctggtcggaccggttcgaccggccggtccgatccgagttttaaaactatg |
32623011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 39061241 - 39061157
Alignment:
| Q |
16 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39061241 |
atgccaaccgaaccggttacccctccggttcacggtcggaccagttcgaccggccggtccagtccggttttcaaaactatgattt |
39061157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 18541485 - 18541561
Alignment:
| Q |
20 |
caaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18541485 |
caaccgaaccggttacccctccggttcacggtcggactggttcgaccggccggtccggtccggttttcaaaactatg |
18541561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 29523199 - 29523120
Alignment:
| Q |
19 |
ccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29523199 |
ccaaccgaaccggttacccatccggttcacggtcggaccggttcgaccagccggtccggtccggttttcaaaactatgat |
29523120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 101
Target Start/End: Original strand, 7154346 - 7154434
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| |||| |
|
|
| T |
7154346 |
aatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccgatctagtccggttttcaaaactatgctttt |
7154434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 96
Target Start/End: Original strand, 31901780 - 31901863
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31901780 |
aatatgtcaaccgaaccgattatccctccggttcacggtcggaccggtccgaccggccgatccggtccggttttcaaaactatg |
31901863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 37314299 - 37314222
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37314299 |
cgaaccggtcaccccaccggttcctggtcggaccggttcaaccggccggtccggtccggttttcaaaactatgctttt |
37314222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 7502156 - 7502228
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
7502156 |
cgaaccggttaccctaccggttcctggtcggaccggttgaaccggccggtccggtccgggtttcaaaactatg |
7502228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 3989750 - 3989806
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| ||||| ||||||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
3989750 |
ccggttcccggtctgaccggtccgaccggccggtccggtccggtttttaaaactatg |
3989806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 6064887 - 6064831
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
6064887 |
ccggttcccggtcggaccggttcgaccgaccgttccgagccggtttttaaaactatg |
6064831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 39 - 98
Target Start/End: Complemental strand, 19262343 - 19262284
Alignment:
| Q |
39 |
tccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
|||||||| ||| |||||||| ||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
19262343 |
tccggttcccgggcggaccggctcgaccggccggtccggtccgatttttaaaactatgat |
19262284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 12341167 - 12341239
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| ||||||| ||| ||||||||| ||||||||||||| |||||||| |||| ||| ||||||||| |
|
|
| T |
12341167 |
cgaaccgcttaccccaccgcttcacggtccaaccggttcgaccggccggtccgagccgggttttaaaactatg |
12341239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 96
Target Start/End: Complemental strand, 21799994 - 21799961
Alignment:
| Q |
63 |
gaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
21799994 |
gaccgaccggtccggtccggtttttaaaactatg |
21799961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 96
Target Start/End: Original strand, 12793578 - 12793661
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||| |||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12793578 |
aatatgtcaaccgaaccagttacccctccagttcacggtcggaccggttcgactgaccggtccggtccggttttcaaaactatg |
12793661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 9294528 - 9294599
Alignment:
| Q |
20 |
caaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgattt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9294528 |
caaccgaaccgattacccctccggttcacggtcggaccgg---------ccggtccggtccggttttcaaaactatgattt |
9294599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 44 - 96
Target Start/End: Original strand, 28235715 - 28235767
Alignment:
| Q |
44 |
ttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
28235715 |
ttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
28235767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 44258515 - 44258590
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
44258515 |
cgaaccggtcaccccaccggttcctggtcggaccggttcaaccggacggtccggtccgattttcaaaactatgatt |
44258590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 48302560 - 48302482
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcga-ccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
||||||||| ||| | || |||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
48302560 |
cgaaccggtcaccacgccagttcacggtcggaccggttcaaaccgtccggtccggtccggttttcaaaactatgctttt |
48302482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 32364975 - 32365031
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
32364975 |
ccggttcacggtcggaccggttcgaccggccggtccgagccggtttttaaaactatg |
32365031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 52586081 - 52586159
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgattttt |
102 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
52586081 |
cgaaccgcttacccctccggttcttggtccaaccggttcgaccggccggtccgagtcggtttttaaaactatgattttt |
52586159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 36 - 75
Target Start/End: Original strand, 20726840 - 20726879
Alignment:
| Q |
36 |
ccctccggttcacggtcggaccggttcgaccgaccggtcc |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20726840 |
ccctccggttcacggtcggaccggttcgaccggccggtcc |
20726879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 46534579 - 46534540
Alignment:
| Q |
19 |
ccaaccgaaccggttacccctccggttcacggtcggaccg |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46534579 |
ccaaccgaaccggttacctctccggttcacggtcggaccg |
46534540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 36 - 77
Target Start/End: Original strand, 18033527 - 18033568
Alignment:
| Q |
36 |
ccctccggttcacggtcggaccggttcgaccgaccggtccgg |
77 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
18033527 |
ccctccgattcacggtcggaccggttcgaccggccggtccgg |
18033568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 27414405 - 27414334
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||| |||| ||||| || || |||||||||||||||| |
|
|
| T |
27414405 |
cgaaccggccaccccaccggttca-ggtcggaccggttcaaccggccggttcgatctggttttcaaaactatg |
27414334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 99
Target Start/End: Original strand, 24639599 - 24639658
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
24639599 |
ccggttccaggttggaccggttcgaccggccggtccgagccggtttttaaaactatgatt |
24639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 19553395 - 19553322
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatga |
97 |
Q |
| |
|
||||||| |||||||||| |||| |||| ||||||||||||| |||||||| || ||||| |||||||||| |
|
|
| T |
19553395 |
cgaaccgcttacccctccagttcttggtccaaccggttcgaccggccggtccgaaccagtttttaaaactatga |
19553322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 96
Target Start/End: Complemental strand, 50357967 - 50357903
Alignment:
| Q |
32 |
ttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||| |||||||| |||||||| |||| |||| |
|
|
| T |
50357967 |
ttacccctccggttctcggtccaaccgattcgaccggccggtccgagccggtttttaaaagtatg |
50357903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 28 - 95
Target Start/End: Original strand, 14910905 - 14910972
Alignment:
| Q |
28 |
ccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactat |
95 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14910905 |
ccggttacctctccggttcacggtcggaccggttcgaccggccggtccgatccggttttcaaaactat |
14910972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 30361261 - 30361339
Alignment:
| Q |
16 |
atgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30361261 |
atgccaaccgaaccggttactcctccgattcacggtcggaccggttcgaccga-----ccgatccggttttcaaaactatgatt |
30361339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 3656555 - 3656627
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
3656555 |
cgaaccggtcatcccaccggttcacggtcggaccggttcaaccggccggtccggtccagttttcaaaactatg |
3656627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 40484745 - 40484689
Alignment:
| Q |
40 |
ccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
40484745 |
ccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
40484689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 25 - 96
Target Start/End: Complemental strand, 27678630 - 27678559
Alignment:
| Q |
25 |
gaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||| ||||| ||||||| |||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
27678630 |
gaaccggtcaccccaccggttcctggtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
27678559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 5969368 - 5969291
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatttt |
101 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||| |||| |||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
5969368 |
cgaaccggtcaccccatcggttcctggtcggaccagttcaaccggccggtccggtccggttttcaatactatgatttt |
5969291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 19725911 - 19725846
Alignment:
| Q |
13 |
aatatgccaaccgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggt |
78 |
Q |
| |
|
|||||| | ||||||| |||||||| |||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19725911 |
aatatgtctaccgaactggttacccatccgattcacggtcagaccggttcgaccgaccggtccggt |
19725846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 98
Target Start/End: Complemental strand, 13486508 - 13486453
Alignment:
| Q |
43 |
gttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgat |
98 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13486508 |
gttcatggtcggaccggttcaaccggccggtccggtccgcttttcaaaactatgat |
13486453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 38209784 - 38209712
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
38209784 |
cgaaccgcttacccctccggttcttggtccaaccggttcgaccggccggtccgagccggtttttaaaactatg |
38209712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 96
Target Start/End: Original strand, 9457400 - 9457457
Alignment:
| Q |
39 |
tccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |||||||| |||| |||| ||||||||| |
|
|
| T |
9457400 |
tccggttcccgggcggaccggttcgaccgcccggtccgatccgatttttaaaactatg |
9457457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 13417 - 13489
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||| ||||| ||| ||| |||||||||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
13417 |
cgaaccggtcaccccaccgcttcctggtcggaccggttcaaccggccggttcggtccggttttcaaaactatg |
13489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 99
Target Start/End: Original strand, 52712 - 52770
Alignment:
| Q |
41 |
cggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
52712 |
cggttcacggtcggaccggttcaaccggtcggtccgatccggtttttaaaactatgatt |
52770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0636 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0636
Description:
Target: scaffold0636; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 2273 - 2343
Alignment:
| Q |
24 |
cgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| || ||||| || ||| ||||||||||||||||||| |
|
|
| T |
2273 |
cgaaccggttacccttccgtttcacggtcggaccggt----ccaaccgg-cctgtctggttttcaaaactatgatt |
2343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 8680 - 8730
Alignment:
| Q |
49 |
ggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatgatt |
99 |
Q |
| |
|
||||||| ||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
8680 |
ggtcggatcggttcgaccggccggtccgagccggttttgaaaactatgatt |
8730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0074 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0074
Description:
Target: scaffold0074; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 54994 - 54920
Alignment:
| Q |
22 |
accgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
|||| ||||| || || ||||||||||||||||||| ||||||||| ||||||| || || ||| ||||||||| |
|
|
| T |
54994 |
accggaccggctaaccatccggttcacggtcggaccagttcgaccggccggtccagttcgagttttaaaactatg |
54920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 96
Target Start/End: Complemental strand, 28653 - 28589
Alignment:
| Q |
32 |
ttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
96 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||||||| || ||||| ||||||||| |
|
|
| T |
28653 |
ttacccctccggttcttggtccaaccggttcgaccggccggtccgagccagtttttaaaactatg |
28589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University