View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_19 (Length: 400)
Name: NF19687_high_19
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 11 - 381
Target Start/End: Complemental strand, 46364950 - 46364580
Alignment:
| Q |
11 |
cagagacgctagaaatgcatagaatccgtttatagcgtccacgccacgagtgtttaacaacgaggtaacgagcaaggtactcaggctcttcgagaggcgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46364950 |
cagagacgctagaaatgcatagaatccgtttatagcgtccgcgccacgagtgtttaacaacgaggtaacgagcaaggtactcaggctcttcgagaggcgg |
46364851 |
T |
 |
| Q |
111 |
aggagttggattagtggcggcggaggtgattgctctgttaacggcggattccatgaacggcggaggaggaagagaaacggaagggttgagatcggaagcg |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46364850 |
aggagttggattagtagcggcggaggtgattgctctgttaacggcggattccatgaccggcggaggaggaagagaaacggaagggttgagatcggaagcg |
46364751 |
T |
 |
| Q |
211 |
taacggcttacggttacagaatcggaaagattagcgagagtgcggacacgtggcgcattgtagaaacggaaaaggaaccagagtccctgcggtgatgaag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46364750 |
taacggcttacggttacagaatcggaaagattagcgagagtgcggacacgtggcgcattgtagaaacggaaaaggaaccagagtccctgcggtgatgaag |
46364651 |
T |
 |
| Q |
311 |
ccgcggggcttccgtgaagccgggactgattcgcccccagttctgtgaattttgttcgattaactcgaacg |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46364650 |
ccgcggggcttccgtgaagccgggactgattcgcccccagttctgtgaattttgttcgattaactcgaacg |
46364580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University