View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_22 (Length: 389)
Name: NF19687_high_22
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 378
Target Start/End: Original strand, 32938737 - 32939119
Alignment:
| Q |
1 |
attggttcactgcctctctgatcaccatgactgcacactttcttctagattggagcaatgcaggaacatttacaatttatgcaattttttctgccatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938737 |
attggttcactgcctctctgatcaccatgactgcacactttcttctagattggagcaatgcaggaacatttacaatttatgcaattttttctgccatcaa |
32938836 |
T |
 |
| Q |
101 |
cgttgcttttgctctactttgggttccagagaccaaggacagaacattggaagaaattcaggcatcgtttattagataattttcatgattaattatttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938837 |
cgttgcttttgctctactttgggttcctgagaccaaggacagaacattggaagaaattcaggcatcgtttattagataattttcatgattaattatttta |
32938936 |
T |
 |
| Q |
201 |
ttctatatataatttatgtgtgaccattaagttttggcacacacaaatccatttgtgttacattggtcttgtataggaaaatctggaaaagaatcctctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938937 |
ttctatatataatttatgtgtgaccattaagttttggtacacacaaatccatttgtgttacattggtcttgtataggaaaatctggaaaagaatcctctc |
32939036 |
T |
 |
| Q |
301 |
tggtaattgaacgca-----tcaccaatctcgactgtcaaatgtaaaattaacgattgtttattgcaacactgttatgatttt |
378 |
Q |
| |
|
|| ||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
32939037 |
tgttaattgaactcatgctgtcaccaatctcgactgtcaaatgtaaaattaacggttgtttattgcaacattgttatgatttt |
32939119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University