View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_38 (Length: 309)
Name: NF19687_high_38
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 15419020 - 15419301
Alignment:
| Q |
19 |
gatggatgagaggagaaattaaatggtacctgcaagattccagcatggtcacctttagcatgatcaggtgtagaattttgccaagttcctggccaatgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419020 |
gatggatgagaggagaaattaaatggtacctgcaagattccagcatggtcacctttagcatgatcaggtgtagaattttgccaagttcctggccaatgag |
15419119 |
T |
 |
| Q |
119 |
taccatcagccatccatgtagctttagggacatcaattgttgtatccggcggtaaaactccgccatttttctccttaactaactgtttttctttcttctc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419120 |
taccatcagccatccatgtagctttagggacatcaattgttgtatccggtggtaaaactccgccatttttctccttaactaactgtttttctttcttctc |
15419219 |
T |
 |
| Q |
219 |
ttccctgctgttatacattttacatcttttctttattacctcaggaagtccattgattctcactttaaattcatcatattct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15419220 |
ttccctgctgttatacattttacatcttttctttattacctcaggtagtccattgattctcactttaaattcatcatattct |
15419301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 143
Target Start/End: Original strand, 29918711 - 29918755
Alignment:
| Q |
99 |
ccaagttcctggccaatgagtaccatcagccatccatgtagcttt |
143 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29918711 |
ccaagtccctggccaatgagatccatcagccatccatgttgcttt |
29918755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University