View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_40 (Length: 297)
Name: NF19687_high_40
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 10 - 281
Target Start/End: Original strand, 26210177 - 26210448
Alignment:
| Q |
10 |
gacatcatcatccgtattatggttttgttcaacccttttaagggttgaactagcaccagaggatgatgatgtcgagcttcttgcagtagcatctgaacta |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210177 |
gacatcatcatctgtattatggttttgttcaacccttttaagggttgaactagcaccagaggatgatgatgtcgagcttcttgcagtagcatctgaacta |
26210276 |
T |
 |
| Q |
110 |
cgcttccgattttcattggagattttttgtggaacctttggttctttatttggaaacaactttgcttcatttttgacatgatcaatgttgttacccttca |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210277 |
cgcttccgattttcattggaaattttttgtggaacctttggttctttatttggaaacaactttgcttcatttttgacatgatcaatgttgttacccttca |
26210376 |
T |
 |
| Q |
210 |
ttggtagggaatgaactaatgagtttcttagcctaggacttttgagattgaaaatcctctccatgaaaccac |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210377 |
ttggtagggaatgaactaatgagtttcttagcctaggacttttgagattgaaaatcctctccatgaaaccac |
26210448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University