View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_45 (Length: 258)
Name: NF19687_high_45
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 34859950 - 34859815
Alignment:
| Q |
1 |
ccttattgctcgtcttctgtgtttcttctttaatttacaaagtcctggaaaagtagaagatggaagccacttcaataacacaaatgttgaagggtttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859950 |
ccttattgctcgtcttctgtgtttcttctttaatttacaaagtcctggaaaagtagaagatggaagccacttcaataacacaaatgttgaagggtttttg |
34859851 |
T |
 |
| Q |
101 |
tgatactatctatctatgcaatggttatcagtatgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34859850 |
tgatactatctatctatgcaatggttatcaatatgt |
34859815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 113 - 185
Target Start/End: Complemental strand, 34859795 - 34859723
Alignment:
| Q |
113 |
tctatgcaatggttatcagtatgttaagacgagttgaagattaaagccaatccaatgacacaattgttgaagg |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859795 |
tctatgaaatggttatcagtatgttaagacgagttgaagattaaagccaatccaatgacacaattgttgaagg |
34859723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 34859640 - 34859590
Alignment:
| Q |
183 |
aggatagttatatgattgtctttctatgaatttcgttacaaatattctatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859640 |
aggatagttatatgattgtctttctatgaatttcgttacaaatattctatg |
34859590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 23133073 - 23132979
Alignment:
| Q |
18 |
tgtgtttcttctttaatttac---aaagtcctggaaaagtagaagatggaagccacttcaataacacaaatgttgaagggtttttgtgatactat |
109 |
Q |
| |
|
|||||||||| |||| ||||| |||||| || ||||||||||||||||||| |||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
23133073 |
tgtgtttcttgtttattttaccgaaaagtcgtgcaaaagtagaagatggaagctacttcaattacacaattgttgaagggcttttgtgatactat |
23132979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University