View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_56 (Length: 249)
Name: NF19687_high_56
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_56 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0010 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 252620 - 252839
Alignment:
| Q |
12 |
aagaatataaagaagaaattgattgtgttcatatggctcttggaggtttttcgagcaacgcagagagatatatttcatcctttgactttggagaaataac |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252620 |
aagaaaataaagaagaaattgattgtgttcatatggctcttggaggtttttcgagcaacgcagagagatatatttcatcctttgactttggagaaataac |
252719 |
T |
|
| Q |
112 |
ccacttgtgtttcttgtaccttagttgaagaaacatgtacatataatcatctaaatcctttcttttacaaaagaacttgtcaatccatagtaaccctcct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
252720 |
ccacttgtgtttcttgtaccttagttgaagaaacatgtacatataatcatctaaatcctttcttttacaaaagaacctatcaatccatagtaaccctcct |
252819 |
T |
|
| Q |
212 |
ggtcttaaaattctatccca |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
252820 |
ggtcttaaaattctatccca |
252839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University