View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_63 (Length: 237)
Name: NF19687_high_63
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 46364976 - 46365203
Alignment:
| Q |
1 |
tgccgttaccaatttctatgatgttgctactgattttgaaggtgctgctcctgttctcagtcgcgatgagaattctaatgagtttagcattagtgtgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46364976 |
tgccgttaccaatttctatgatgttgctactgattttgaaggtgctgctcctgttctcagtcgcgatgagaattctattgagtttagcattagtgtgagg |
46365075 |
T |
 |
| Q |
101 |
actgatggacgtggaaaattcaaagcgatgaagttttcatccatgtatagggcgagcattttgactgagttgcatcggataagatggagtcggttggcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46365076 |
actgatggacgtggaaaattcaaagcgatgaagttttcatccatgtatagggcgagtattttgactgagttgcatcggataagatggaatcggttggcgc |
46365175 |
T |
 |
| Q |
201 |
cggttgctgagtttcctgtgcttcatct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
46365176 |
cggttgctgagtttcctgtgcttcatct |
46365203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University