View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_67 (Length: 223)
Name: NF19687_high_67
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 28 - 212
Target Start/End: Original strand, 1331175 - 1331352
Alignment:
| Q |
28 |
tcgttggttaatccctcggaaggttgtggaaaatgtagatcgtggtnnnnnnnnccc-gcatatgtttcaaagaaaacaattcataaatatgttgacaag |
126 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1331175 |
tcgttggttgatccctcggaagattgtggaaaatgtagatcatggtaaaaaaaaacctgcatatgtttcgaagaaaacaattcataaatatgttgacaag |
1331274 |
T |
|
| Q |
127 |
gagaatacatacggcatagcatcctccaaggcttttgaagcgcgggtgcaacacttgttattactcatgttgaaaattttgttgat |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1331275 |
gagaatgcatacggcatagcatcctccaaggcttttgaagtgc--------cacttgttattactcatgttgaaaattttgttgat |
1331352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University