View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_high_68 (Length: 214)
Name: NF19687_high_68
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 39100129 - 39100253
Alignment:
| Q |
1 |
ggatgatataataaaaatgaggatgttgcccgttgccaccttgtacaacatgcagatacagaattttttgaagggttttacgtgatacaacatgttttat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39100129 |
ggatgatataataaaa-tgaggatgttgcccgttgccaccttgtacaacatgcagatacagaattttttgaagggttttacgtgatacaacatgttttat |
39100227 |
T |
 |
| Q |
101 |
acagaatgaagttctttgaatgctac |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39100228 |
acagaatgaagttctttgaatgctac |
39100253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 137 - 192
Target Start/End: Original strand, 39100356 - 39100411
Alignment:
| Q |
137 |
agttgaacaagcaaactcagtcaaattgaagttttattctaaaaaaggattctata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39100356 |
agttgaacaagcaaactcagtcaaattgaagttttattctaaaaaaggattctata |
39100411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University