View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19687_high_69 (Length: 212)

Name: NF19687_high_69
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19687_high_69
NF19687_high_69
[»] chr8 (2 HSPs)
chr8 (19-85)||(32335167-32335233)
chr8 (150-195)||(32335298-32335343)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 32335167 - 32335233
Alignment:
19 atatgataaccattctaaatcagcagcttcttctacctacaaaaattgcaactttggttaaattctt 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32335167 atatgataaccattctaaatcagcagcttcttctacctacaaaaattgcaactttggttaaattctt 32335233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 32335298 - 32335343
Alignment:
150 aatgtaagaggaagagagagagtaccggaacggtgagttcggtagt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
32335298 aatgtaagaggaagagagagagtaccggaacggtgagttcggtagt 32335343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University