View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_22 (Length: 395)
Name: NF19687_low_22
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 63 - 384
Target Start/End: Complemental strand, 37192241 - 37191920
Alignment:
| Q |
63 |
gtgcttaactagttaagctagtttggatgaagtatttatcatgtcgacgggtgcatacatcctcttatcatgtgaagataatgacctacagagacaaggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37192241 |
gtgcttaactagttaagctagtttggatgaagtatttatcatgtcgacgggtgcatacatcctcttatcatgtgaagataatgacctacagagacaaggg |
37192142 |
T |
 |
| Q |
163 |
aggatgtttccaccatgtaaaggaggatgtctcttattcaacggatgtggaaacattaaatttcttcgttaaatatcacgaaatcatgacacgtgtcggt |
262 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
37192141 |
aggatgtttccaccatgcaaaggaggatgtctcttattcaacggatgtggaaacgttaaatttcttcgttaaacatcacgaaatcatgacacgtgtcagt |
37192042 |
T |
 |
| Q |
263 |
cattatcgtgacgtcacccataagattccacttttacagaacccacgtgagtcagaaacgcaatagtcacatgactattgttgagttaggaccccatcca |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37192041 |
cattatcgtgacgtcacccataagattccacttttacagaacccacgtgagtcagaaacgcaatagtcacatgactattgttgagttaggaccccatcca |
37191942 |
T |
 |
| Q |
363 |
atcagtatgggccacgtttcat |
384 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37191941 |
atcagtatgggccacgtttcat |
37191920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 37192622 - 37192593
Alignment:
| Q |
1 |
ttaaaattaattgtctaactgatgtattgg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37192622 |
ttaaaattaattgtctaactgatgtattgg |
37192593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University