View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_39 (Length: 310)
Name: NF19687_low_39
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 33887006 - 33887260
Alignment:
| Q |
13 |
aatatcaaagttgtacctacaaacaacgcagcaaagttgttagttagttagggtttgattctgccactgcacag------ggacagggaatagatcactg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33887006 |
aatatcaaagttgtacctacaaacaacgcagtaaagttgttggttagttagggtttgattctgccactgcacagggacagggacagggaatagatcactg |
33887105 |
T |
 |
| Q |
107 |
ctcacattccgtatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatattcttacttctcagcaaatctct |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33887106 |
ctcacattccttatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatatacttacttctcagcaaatctct |
33887205 |
T |
 |
| Q |
207 |
tccgctcttccctctcaaaatttgcaaagaattcatcaatctcctcttccctgaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33887206 |
tccgctcttccctctcaaaatttgcaaagaattcatcaatctccgcctccctgaa |
33887260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University