View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19687_low_44 (Length: 283)

Name: NF19687_low_44
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19687_low_44
NF19687_low_44
[»] chr7 (1 HSPs)
chr7 (16-234)||(41991082-41991300)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 41991300 - 41991082
Alignment:
16 agaagaaaggctgcgatgggcgattagtgtgtgtgttataatcacacgagtgtagagtgaaactctcctcactggattactattggggatcgagattaga 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41991300 agaagaaaggctgcgatgggcgattagtgtgtgtgttataatcacacgagtgtagagtgaaactctcctcactggattactattggggatcgagattaga 41991201  T
116 ttttatcacttcaccggattaaaaacacaatcattgtttctcagtaatattcagttgaaaattaaaatttggtgtgcttgtaataaggggtgaataaaag 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41991200 ttttatcacttcaccggattaaaaacacaatcattgtttctcagtaatattcagttgaaaattaaaatttggtgtgcttgtaataaggggtgaataaaag 41991101  T
216 agatgcaaagggcttgacc 234  Q
    |||||||||||||||||||    
41991100 agatgcaaagggcttgacc 41991082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University