View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_44 (Length: 283)
Name: NF19687_low_44
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 41991300 - 41991082
Alignment:
| Q |
16 |
agaagaaaggctgcgatgggcgattagtgtgtgtgttataatcacacgagtgtagagtgaaactctcctcactggattactattggggatcgagattaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41991300 |
agaagaaaggctgcgatgggcgattagtgtgtgtgttataatcacacgagtgtagagtgaaactctcctcactggattactattggggatcgagattaga |
41991201 |
T |
 |
| Q |
116 |
ttttatcacttcaccggattaaaaacacaatcattgtttctcagtaatattcagttgaaaattaaaatttggtgtgcttgtaataaggggtgaataaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41991200 |
ttttatcacttcaccggattaaaaacacaatcattgtttctcagtaatattcagttgaaaattaaaatttggtgtgcttgtaataaggggtgaataaaag |
41991101 |
T |
 |
| Q |
216 |
agatgcaaagggcttgacc |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41991100 |
agatgcaaagggcttgacc |
41991082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University