View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_52 (Length: 251)
Name: NF19687_low_52
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_52 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 52877291 - 52877235
Alignment:
| Q |
195 |
gtaagacttactgtaatcataacactcttctgaaatatcaccggggatatgaatacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52877291 |
gtaagacttactgtaatcataacactcttctggaatatcaccggggatatgaatacc |
52877235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 52877470 - 52877428
Alignment:
| Q |
18 |
atctagaaagaaacatgaaaatgtagatatttatagcaagatg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52877470 |
atctagaaagaaacatgaaaatgtagatatttatagcaagatg |
52877428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University