View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_54 (Length: 250)
Name: NF19687_low_54
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 40142736 - 40142520
Alignment:
| Q |
16 |
ataaggcttaaacatgttttgaggtcatcaagcaagataaatatcgttcttgtgcatgtttgaaatcaaaggtggatttgacaaaatcatggtgacttgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40142736 |
ataaggcttaaacatgttttgaggtcatcaagcaagataaatatcgttcttctgcatgtttgaaatcac-ggtggatttgacaaaatcatggtgacttgg |
40142638 |
T |
|
| Q |
116 |
ttgatgtttcaaagtgtcgtttttgcaaaatcatggtatgccaaacacaccatcaattcaaacatgcactttgtatctcaaaaaagttttgttgcttttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40142637 |
ttgatgtttcaaagtgtcgtttttgcaaaatcatggtttgccaaacactccatcaattcaaacatgcactttgtatctcgaaaaagttttgttgcttttt |
40142538 |
T |
|
| Q |
216 |
tcaaaatgatcataattg |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40142537 |
tcaaaatgatcataattg |
40142520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University