View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_63 (Length: 238)
Name: NF19687_low_63
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 33887746 - 33887965
Alignment:
| Q |
1 |
gtgatttttcttttcttggaaatggaagttccgttagctataattgttggagaagaacgtttacaatcactcattttttgtt-gctattttaagatgagg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
33887746 |
gtgatttttcttttcttggaaatggaagttccgttagctataattgttggagaagaacgtttacaatcactcattttttttttgctatttttagatgagg |
33887845 |
T |
 |
| Q |
100 |
gagagagcgaagtggaagaagaaggagcttaaaaagagagtgtgatcgaatagaaatgttaacgagggtaatgattacaatggacggtccagatttatta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887846 |
gagagagcgaagtggaagaagaaggagcttaaaaagagagtgtgatcgaatagaaatgttaacgagggtaatgattacaatggacggtccagatttatta |
33887945 |
T |
 |
| Q |
200 |
aataactgtagtagggaggg |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33887946 |
aataactgtagtagggaggg |
33887965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University