View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_64 (Length: 237)
Name: NF19687_low_64
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 42622073 - 42621869
Alignment:
| Q |
12 |
tagcataggtcagtttctgtagtggacaacagttataaatggcaaaaattgttgccaagttttggtatcatgctaatgatgagtacaagacacagacact |
111 |
Q |
| |
|
||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622073 |
tagcagagttcagtttctttagtggacaacagttataaatggcaaaaattgttgccaagttttggtatcatgctaatgatgagtacaagacacagacact |
42621974 |
T |
|
| Q |
112 |
tcaaattaccccaacctacgtacttccaacgtttcgcccaacatagcctactgattgactttttatcgagtatatcaatggcaatacctcactttatcac |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42621973 |
tcaaattaccccaacc----tacttccaacgtttcgcccaacatagcctactgattgactttttatcgagtatatcaatggcaatacctcactttatcac |
42621878 |
T |
|
| Q |
212 |
gtggaccat |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
42621877 |
gtggaccat |
42621869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University